knockout kit Search Results


95
Chem Impex International 01523 cas
01523 Cas, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/01523 cas/product/Chem Impex International
Average 95 stars, based on 1 article reviews
01523 cas - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

90
OriGene kn204066
Kn204066, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/kn204066/product/OriGene
Average 90 stars, based on 1 article reviews
kn204066 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

94
OriGene grb2 knockout
Grb2 Knockout, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grb2 knockout/product/OriGene
Average 94 stars, based on 1 article reviews
grb2 knockout - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

92
OriGene smurf2 crispr cells
<t>SMURF2</t> physically interacts with ADAR1p110. A Reciprocal co-IPs showing interactions between MYC-SMURF2 and FLAG-ADAR1p110 in HEK-293T cells. Proteins were released from the beads using an 8 M urea elution buffer. WCL, whole cell lysates. B co-IP analysis showing interaction between endogenous SMURF2 and ADAR1 under various lysis conditions: #1—lysed with a buffer containing 0.5% NP-40; #2—1% NP-40; #3—600 mM KCL, no detergent (freezing–thawing buffer). C co-IPs showing interactions between either FLAG- or GFP-SMURF2 and endogenous ADAR1 in U2OS cells. D STED microscopy images showing colocalization of GFP-SMURF2 and ADAR1 in the U2OS cell nucleus. Scale bar: 5 μm. White rectangles mark the area detailed under the STED microscopy. Scale bar in the bottom images: 0.2 μm. E PLA images showing the sites of interactions between GFP-SMURF2 and ADAR1 in U2OS cells (red fluorescence spots). Scale bar: 20 μm. F Quantifications of the PLA data on SMURF2–ADAR1 interaction in U2OS cell nuclei. 100 cells/sample. Data are mean ± SEM. ****P ≤ 0.0001. G In vitro binding assay (GST pull-down) showing direct interaction between GST-SMURF2 and FLAG-ADAR1p110. H In vitro binding assay (FLAG pull-down) showing the interaction between FLAG-ADAR1p110 and untagged SMURF2. I In vitro binding assay showing that both SMURF2 wild-type and its catalytically dead mutant (SMURF2Mut) are capable of interacting directly with ADAR1p110
Smurf2 Crispr Cells, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/smurf2 crispr cells/product/OriGene
Average 92 stars, based on 1 article reviews
smurf2 crispr cells - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

90
OriGene hhat t47d
(A–D) Microsomal membranes from control or <t>Hhat</t> −/− <t>T47D</t> cells (A and B) or Hhat −/− MEFs (C and D) were pretreated for 15 min with 10 μM TDI-3410, 10 μM Etomoxir, or both drugs, and the uptake of NBD-palmitoyl-CoA (A and C) or [ 125 I] IodoPalmitoyl-CoA (B and D) was determined as described in . (A) n = 4; (B) n = 2; (C) n = 3; and (D) n = 2. (E) Microsomal membranes from (C) were pretreated for 15 min with 10 μM TDI-3410, 10 μM Etomoxir, or both drugs, and the NBD-palmitoyl-CoA uptake assay was performed at room temperature or at 0°; n = 3.
Hhat T47d, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hhat t47d/product/OriGene
Average 90 stars, based on 1 article reviews
hhat t47d - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

92
OriGene crispr cd28 human knockout kit
(A–D) Microsomal membranes from control or <t>Hhat</t> −/− <t>T47D</t> cells (A and B) or Hhat −/− MEFs (C and D) were pretreated for 15 min with 10 μM TDI-3410, 10 μM Etomoxir, or both drugs, and the uptake of NBD-palmitoyl-CoA (A and C) or [ 125 I] IodoPalmitoyl-CoA (B and D) was determined as described in . (A) n = 4; (B) n = 2; (C) n = 3; and (D) n = 2. (E) Microsomal membranes from (C) were pretreated for 15 min with 10 μM TDI-3410, 10 μM Etomoxir, or both drugs, and the NBD-palmitoyl-CoA uptake assay was performed at room temperature or at 0°; n = 3.
Crispr Cd28 Human Knockout Kit, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crispr cd28 human knockout kit/product/OriGene
Average 92 stars, based on 1 article reviews
crispr cd28 human knockout kit - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

90
OriGene ppia cypha crispr system
A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. <t>CRISPR/Cas9</t> knockout of <t>PPIA</t> /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .
Ppia Cypha Crispr System, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ppia cypha crispr system/product/OriGene
Average 90 stars, based on 1 article reviews
ppia cypha crispr system - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

94
OriGene β catenin
A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. <t>CRISPR/Cas9</t> knockout of <t>PPIA</t> /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .
β Catenin, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/β catenin/product/OriGene
Average 94 stars, based on 1 article reviews
β catenin - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

93
OriGene crispr guide rna plasmids
A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. <t>CRISPR/Cas9</t> knockout of <t>PPIA</t> /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .
Crispr Guide Rna Plasmids, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crispr guide rna plasmids/product/OriGene
Average 93 stars, based on 1 article reviews
crispr guide rna plasmids - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
OriGene kn409747
A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. <t>CRISPR/Cas9</t> knockout of <t>PPIA</t> /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .
Kn409747, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/kn409747/product/OriGene
Average 93 stars, based on 1 article reviews
kn409747 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
OriGene ldl receptor ldlr human gene knockout kit
A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. <t>CRISPR/Cas9</t> knockout of <t>PPIA</t> /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .
Ldl Receptor Ldlr Human Gene Knockout Kit, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ldl receptor ldlr human gene knockout kit/product/OriGene
Average 93 stars, based on 1 article reviews
ldl receptor ldlr human gene knockout kit - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
OriGene dbr1 ko cells
Human <t>Dbr1</t> has a disordered C-terminal domain. A , summary of primary sequence alignment of Dbr1 homologs from human, mice, yeast, and amoeba. The catalytic metallophosphoesterase (MPE) domain is conserved across phyla. The lariat-recognition loop (LRL) is unique to Dbr1 enzymes. Metazoan Dbr1 enzymes have a long, conserved C-terminal domain that is absent in lower eukaryotes. B , the C-terminal domain is predicted to be disordered based on the primary sequence (PONDR analysis). C , predicted 3 dimensional structure of human Dbr1 colored by pLDDT score, with blue = high confidence and red = low confidence. The active site metals are shown as spheres . The C terminus is red and lacks secondary structure. D , 1D proton NMR confirms that human Dbr1 contains random-coil polypeptide when expressed in either E. coli ( black spectra ) or Sf9 insect cells ( red spectra ). The methyl region is shown ( middle ) with the regions corresponding to random coil and structured polypeptide labeled. The amide region is identical for both preparations ( bottom ).
Dbr1 Ko Cells, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dbr1 ko cells/product/OriGene
Average 93 stars, based on 1 article reviews
dbr1 ko cells - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

Image Search Results


SMURF2 physically interacts with ADAR1p110. A Reciprocal co-IPs showing interactions between MYC-SMURF2 and FLAG-ADAR1p110 in HEK-293T cells. Proteins were released from the beads using an 8 M urea elution buffer. WCL, whole cell lysates. B co-IP analysis showing interaction between endogenous SMURF2 and ADAR1 under various lysis conditions: #1—lysed with a buffer containing 0.5% NP-40; #2—1% NP-40; #3—600 mM KCL, no detergent (freezing–thawing buffer). C co-IPs showing interactions between either FLAG- or GFP-SMURF2 and endogenous ADAR1 in U2OS cells. D STED microscopy images showing colocalization of GFP-SMURF2 and ADAR1 in the U2OS cell nucleus. Scale bar: 5 μm. White rectangles mark the area detailed under the STED microscopy. Scale bar in the bottom images: 0.2 μm. E PLA images showing the sites of interactions between GFP-SMURF2 and ADAR1 in U2OS cells (red fluorescence spots). Scale bar: 20 μm. F Quantifications of the PLA data on SMURF2–ADAR1 interaction in U2OS cell nuclei. 100 cells/sample. Data are mean ± SEM. ****P ≤ 0.0001. G In vitro binding assay (GST pull-down) showing direct interaction between GST-SMURF2 and FLAG-ADAR1p110. H In vitro binding assay (FLAG pull-down) showing the interaction between FLAG-ADAR1p110 and untagged SMURF2. I In vitro binding assay showing that both SMURF2 wild-type and its catalytically dead mutant (SMURF2Mut) are capable of interacting directly with ADAR1p110

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: The E3 ubiquitin ligase SMURF2 stabilizes RNA editase ADAR1p110 and promotes its adenosine-to-inosine (A-to-I) editing function

doi: 10.1007/s00018-022-04272-8

Figure Lengend Snippet: SMURF2 physically interacts with ADAR1p110. A Reciprocal co-IPs showing interactions between MYC-SMURF2 and FLAG-ADAR1p110 in HEK-293T cells. Proteins were released from the beads using an 8 M urea elution buffer. WCL, whole cell lysates. B co-IP analysis showing interaction between endogenous SMURF2 and ADAR1 under various lysis conditions: #1—lysed with a buffer containing 0.5% NP-40; #2—1% NP-40; #3—600 mM KCL, no detergent (freezing–thawing buffer). C co-IPs showing interactions between either FLAG- or GFP-SMURF2 and endogenous ADAR1 in U2OS cells. D STED microscopy images showing colocalization of GFP-SMURF2 and ADAR1 in the U2OS cell nucleus. Scale bar: 5 μm. White rectangles mark the area detailed under the STED microscopy. Scale bar in the bottom images: 0.2 μm. E PLA images showing the sites of interactions between GFP-SMURF2 and ADAR1 in U2OS cells (red fluorescence spots). Scale bar: 20 μm. F Quantifications of the PLA data on SMURF2–ADAR1 interaction in U2OS cell nuclei. 100 cells/sample. Data are mean ± SEM. ****P ≤ 0.0001. G In vitro binding assay (GST pull-down) showing direct interaction between GST-SMURF2 and FLAG-ADAR1p110. H In vitro binding assay (FLAG pull-down) showing the interaction between FLAG-ADAR1p110 and untagged SMURF2. I In vitro binding assay showing that both SMURF2 wild-type and its catalytically dead mutant (SMURF2Mut) are capable of interacting directly with ADAR1p110

Article Snippet: SMURF2 CRISPR cells were generated by using the CRISPR/Cas9 genome editing tool (Cat# KN210866 , Origene), as described [ 41 ].

Techniques: Co-Immunoprecipitation Assay, Lysis, Microscopy, Fluorescence, In Vitro, Binding Assay, Mutagenesis

SMURF2 ubiquitinates ADAR1p110 in a direct manner. A Western blot analysis of in cellulo ubiquitination assays conducted in HEK-293T cells under different cell lysis conditions. B Quantification of data on the effects of SMURF2 on ADAR1 ubiquitination shown in A obtained in three independent experiments. Data are mean ± SEM. ***P ≤ 0.001, ****P ≤ 0.0001. C In cellulo ubiquitination assay showing the disappearance of SMURF2-mediated oligoubiquitination of ADAR1 (marked in the red box) in HEK-293T cells coexpressing HA-Ubiquitin-KO mutant. D Quantification of the data shown in C obtained in four different experiments. The intensity of oligo-ubiquitinated ADAR1 was normalized to the intensity of FLAG-ADAR1p110 in the IP samples and calculated as a fold change relatively the corresponding controls. Data are mean ± SEM. *P ≤ 0.05. E In vitro ubiquitination of MYC-ADAR1p110 by GST-SMURF2. MYC-ADAR1p110 was pulled-down from the reaction using anti-MYC antibody. Coomassie blue gel staining on the right shows GST, GST-SMURF2 (active and mutant) and MYC-ADAR1p110 proteins used in the study. F Quantification of the data shown in E from two separate experiments. The ubiquitination levels of MYC-ADAR1p110 were normalized to its levels in the IP samples. Data are mean ± SEM. *P ≤ 0.05

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: The E3 ubiquitin ligase SMURF2 stabilizes RNA editase ADAR1p110 and promotes its adenosine-to-inosine (A-to-I) editing function

doi: 10.1007/s00018-022-04272-8

Figure Lengend Snippet: SMURF2 ubiquitinates ADAR1p110 in a direct manner. A Western blot analysis of in cellulo ubiquitination assays conducted in HEK-293T cells under different cell lysis conditions. B Quantification of data on the effects of SMURF2 on ADAR1 ubiquitination shown in A obtained in three independent experiments. Data are mean ± SEM. ***P ≤ 0.001, ****P ≤ 0.0001. C In cellulo ubiquitination assay showing the disappearance of SMURF2-mediated oligoubiquitination of ADAR1 (marked in the red box) in HEK-293T cells coexpressing HA-Ubiquitin-KO mutant. D Quantification of the data shown in C obtained in four different experiments. The intensity of oligo-ubiquitinated ADAR1 was normalized to the intensity of FLAG-ADAR1p110 in the IP samples and calculated as a fold change relatively the corresponding controls. Data are mean ± SEM. *P ≤ 0.05. E In vitro ubiquitination of MYC-ADAR1p110 by GST-SMURF2. MYC-ADAR1p110 was pulled-down from the reaction using anti-MYC antibody. Coomassie blue gel staining on the right shows GST, GST-SMURF2 (active and mutant) and MYC-ADAR1p110 proteins used in the study. F Quantification of the data shown in E from two separate experiments. The ubiquitination levels of MYC-ADAR1p110 were normalized to its levels in the IP samples. Data are mean ± SEM. *P ≤ 0.05

Article Snippet: SMURF2 CRISPR cells were generated by using the CRISPR/Cas9 genome editing tool (Cat# KN210866 , Origene), as described [ 41 ].

Techniques: Western Blot, Lysis, Ubiquitin Assay, Mutagenesis, In Vitro, Staining

SMURF2 stabilizes ADAR1p110 in an E3 ubiquitin ligase-dependent manner. A Immunoblot analysis showing the effect of the induction of DD-SMURF2 (arrow-labeled) with Shield-1 on ADAR1p110 expression in U2OS cells. Cells were treated with 1 nM of Shield-1 for the indicated period/s of time. The quantification of the relative protein levels of ADAR1p110 and DD-SMURF2 at different time-points after Shield-1 treatment is shown on the right. B Western blot analysis showing the dependence of the phenomenon shown in A on the unaltered catalytic activity of SMURF2. Cells were treated with 1 nM of Shield-1 for 30 min. The arrow shows the induced wild-type and mutant forms of DD-SMURF2. C Quantification of data shown in B from two separate experiments. Data are mean ± SEM. *P ≤ 0.05. D Western blot analysis showing that overexpression of catalytically active GFP-SMURF2, but not its E3 ligase-dead form GFP-SMURF2Mut, increases ADAR1p110 protein levels. E SMURF2 knockdown diminishes protein levels of ADAR1p110. F Western blot analysis showing the effect of SMURF2 knockdown on the steady-state levels of ADAR1p110 in different types of cells. Non-silencing siRNA (siNS) and shRNA directed against Luciferase (shLuc) were used as controls for siRNA and shRNA experiments, respectively. G Immunoblot analysis of ADAR1 protein expression in SMURF2 knockdown PC3 cells after treatment with MG-132 (5 μM; 4 h) and chloroquine, CQ (50 μM; 4 h). Inhibition of the proteasomal and lysosomal degradation pathways was verified using anti-poly-ubiquitin-K48 and anti-LC3B antibodies, respectively. H Western blot analysis of ADAR1 expression in Smurf2-depleted and wild-type mouse tissues. The expression levels of the SCF subunit β-TrCP were also examined (explained in the “Discussion” section). I The quantification of data on the effect of SMURF2 on ADAR1 shown in G obtained on three different pairs of mice. Data are mean ± SEM. *P ≤ 0.05, **P ≤ 0.01

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: The E3 ubiquitin ligase SMURF2 stabilizes RNA editase ADAR1p110 and promotes its adenosine-to-inosine (A-to-I) editing function

doi: 10.1007/s00018-022-04272-8

Figure Lengend Snippet: SMURF2 stabilizes ADAR1p110 in an E3 ubiquitin ligase-dependent manner. A Immunoblot analysis showing the effect of the induction of DD-SMURF2 (arrow-labeled) with Shield-1 on ADAR1p110 expression in U2OS cells. Cells were treated with 1 nM of Shield-1 for the indicated period/s of time. The quantification of the relative protein levels of ADAR1p110 and DD-SMURF2 at different time-points after Shield-1 treatment is shown on the right. B Western blot analysis showing the dependence of the phenomenon shown in A on the unaltered catalytic activity of SMURF2. Cells were treated with 1 nM of Shield-1 for 30 min. The arrow shows the induced wild-type and mutant forms of DD-SMURF2. C Quantification of data shown in B from two separate experiments. Data are mean ± SEM. *P ≤ 0.05. D Western blot analysis showing that overexpression of catalytically active GFP-SMURF2, but not its E3 ligase-dead form GFP-SMURF2Mut, increases ADAR1p110 protein levels. E SMURF2 knockdown diminishes protein levels of ADAR1p110. F Western blot analysis showing the effect of SMURF2 knockdown on the steady-state levels of ADAR1p110 in different types of cells. Non-silencing siRNA (siNS) and shRNA directed against Luciferase (shLuc) were used as controls for siRNA and shRNA experiments, respectively. G Immunoblot analysis of ADAR1 protein expression in SMURF2 knockdown PC3 cells after treatment with MG-132 (5 μM; 4 h) and chloroquine, CQ (50 μM; 4 h). Inhibition of the proteasomal and lysosomal degradation pathways was verified using anti-poly-ubiquitin-K48 and anti-LC3B antibodies, respectively. H Western blot analysis of ADAR1 expression in Smurf2-depleted and wild-type mouse tissues. The expression levels of the SCF subunit β-TrCP were also examined (explained in the “Discussion” section). I The quantification of data on the effect of SMURF2 on ADAR1 shown in G obtained on three different pairs of mice. Data are mean ± SEM. *P ≤ 0.05, **P ≤ 0.01

Article Snippet: SMURF2 CRISPR cells were generated by using the CRISPR/Cas9 genome editing tool (Cat# KN210866 , Origene), as described [ 41 ].

Techniques: Western Blot, Labeling, Expressing, Activity Assay, Mutagenesis, Over Expression, shRNA, Luciferase, Inhibition

Mapping on ADAR1 of SMURF2 ubiquitination sites and identification of K744 as a residue essential for ADAR1 stability maintenance. A Schematic diagram showing the position of identified lysine residues of ADAR1p110 as ubiquitination sites of SMURF2. B Western blot analysis showing the effects of K-to-R mutations of ADAR1p110 on its ubiquitination and expression levels in HEK-293T cells. C Quantification of the data shown in B from several independent experiments. The data for ADAR1-WT and K744R mutant were collected from three independent experiments; the experiments with all other listed mutants were performed twice. Data are mean ± SEM. D Western blot analysis of in cellulo ubiquitination assay conducted with different ADAR1 mutant combinations. E Quantification of the data described in D derived from three independent experiments. Data are mean ± SEM. F Confocal microscopy images showing expression of ADAR1-WT, ADAR1-K296R and ADAR1-K744 mutants in U2OS and HeLa cells. Scale bar: 5 μm. G Quantification of the data shown in F collected on 50–52 cells per sample. Data are mean ± SEM. ****P ≤ 0.0001. NS nonsignificant. H Western blot analysis showing that degradation of ADAR1-K744R can be rescued through the inhibition of its proteasomal and lysosomal turnover, using MG-132 and CQ treatments, respectively. Inhibition of the proteasomal and lysosomal degradation pathways were verified using anti-poly-ubiquitin-K48 and anti-LC3B antibodies, respectively. HEK-293T cells. I Quantification of the data described in H from three independent experiments. Data are mean ± SEM. *P ≤ 0.05, **P ≤ 0.01. J Western blot analysis showing protein turnover of ADAR1-WT and ADAR1-K744R in cycloheximide (CHX)-treated HEK-293T cells. CHX was administered to cells at a concentration of 50 μg/ml for the indicated period/s of time. K Quantification of the data described in J obtained in three independent experiments. Data are mean ± SEM. *P ≤ 0.05, **P ≤ 0.01, ****P ≤ 0.0001. The expression levels (relative ODs) of ADAR1-WT and ADAR1-K744R were normalized to β-actin and calculated relatively to untreated ADAR1-WT control (lane 1). These values were also calculated relatively to each of the untreated controls: WT and K744R (shown in Supplementary Fig. 4D)

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: The E3 ubiquitin ligase SMURF2 stabilizes RNA editase ADAR1p110 and promotes its adenosine-to-inosine (A-to-I) editing function

doi: 10.1007/s00018-022-04272-8

Figure Lengend Snippet: Mapping on ADAR1 of SMURF2 ubiquitination sites and identification of K744 as a residue essential for ADAR1 stability maintenance. A Schematic diagram showing the position of identified lysine residues of ADAR1p110 as ubiquitination sites of SMURF2. B Western blot analysis showing the effects of K-to-R mutations of ADAR1p110 on its ubiquitination and expression levels in HEK-293T cells. C Quantification of the data shown in B from several independent experiments. The data for ADAR1-WT and K744R mutant were collected from three independent experiments; the experiments with all other listed mutants were performed twice. Data are mean ± SEM. D Western blot analysis of in cellulo ubiquitination assay conducted with different ADAR1 mutant combinations. E Quantification of the data described in D derived from three independent experiments. Data are mean ± SEM. F Confocal microscopy images showing expression of ADAR1-WT, ADAR1-K296R and ADAR1-K744 mutants in U2OS and HeLa cells. Scale bar: 5 μm. G Quantification of the data shown in F collected on 50–52 cells per sample. Data are mean ± SEM. ****P ≤ 0.0001. NS nonsignificant. H Western blot analysis showing that degradation of ADAR1-K744R can be rescued through the inhibition of its proteasomal and lysosomal turnover, using MG-132 and CQ treatments, respectively. Inhibition of the proteasomal and lysosomal degradation pathways were verified using anti-poly-ubiquitin-K48 and anti-LC3B antibodies, respectively. HEK-293T cells. I Quantification of the data described in H from three independent experiments. Data are mean ± SEM. *P ≤ 0.05, **P ≤ 0.01. J Western blot analysis showing protein turnover of ADAR1-WT and ADAR1-K744R in cycloheximide (CHX)-treated HEK-293T cells. CHX was administered to cells at a concentration of 50 μg/ml for the indicated period/s of time. K Quantification of the data described in J obtained in three independent experiments. Data are mean ± SEM. *P ≤ 0.05, **P ≤ 0.01, ****P ≤ 0.0001. The expression levels (relative ODs) of ADAR1-WT and ADAR1-K744R were normalized to β-actin and calculated relatively to untreated ADAR1-WT control (lane 1). These values were also calculated relatively to each of the untreated controls: WT and K744R (shown in Supplementary Fig. 4D)

Article Snippet: SMURF2 CRISPR cells were generated by using the CRISPR/Cas9 genome editing tool (Cat# KN210866 , Origene), as described [ 41 ].

Techniques: Residue, Western Blot, Expressing, Mutagenesis, Ubiquitin Assay, Derivative Assay, Confocal Microscopy, Inhibition, Concentration Assay

SMURF2-insensitive ADAR1-K744R mutant is enzymatically incompetent. A Sanger sequencing chromatograms showing the efficiency of RNA editing of the FLNB transcript in HEK-293T cells 24 and 48 h after cell transfection with the indicated vectors and constructs. Note that, in the chromatograms, the editing site appears as mixed A and G peaks. The edited position is indicated by arrows. B Western blot analysis showing expression of ADAR1p110-WT and its K296R, K744R and enzymatically inactive mutants (H615Q/E617A, denoted as E617A) 24 and 48 h after cell transfection. The data are related to the results described in A. C Quantification of RNA editing of FLNB transcript described in A obtained from three independent experiments. Data are mean ± SEM. **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001. D Sanger sequencing chromatograms showing RNA editing of FLNB and AZIN1 in HeLa cells 48 h after cell transfection. E Western blot analysis showing expression of ADAR1-WT and its mutants in HeLa cells. F Quantification of the data on RNA editing of FLNB and AZIN1 transcripts in HeLa cells obtained from four independent experiments. Data are mean ± SEM. ***P ≤ 0.001, ****P ≤ 0.0001. G Sanger sequencing chromatograms showing the efficiency of FLNB editing 24 and 48 h after cell transfection with either equal amounts of ADAR1 (4 μg for both WT and K744R) or at the threefold increase of ADAR1-K744R mutant (4 μg for WT and 12 μg for K744R) to equalize expression of K744R to its WT counterpart. H Immunoblot analysis showing expression levels ADAR1-WT and ADAR1-K744R described in G. I Quantification of the data on RNA editing of FLNB transcript described in (G and H) obtained from three independent experiments. Data are Mean ± SEM. **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: The E3 ubiquitin ligase SMURF2 stabilizes RNA editase ADAR1p110 and promotes its adenosine-to-inosine (A-to-I) editing function

doi: 10.1007/s00018-022-04272-8

Figure Lengend Snippet: SMURF2-insensitive ADAR1-K744R mutant is enzymatically incompetent. A Sanger sequencing chromatograms showing the efficiency of RNA editing of the FLNB transcript in HEK-293T cells 24 and 48 h after cell transfection with the indicated vectors and constructs. Note that, in the chromatograms, the editing site appears as mixed A and G peaks. The edited position is indicated by arrows. B Western blot analysis showing expression of ADAR1p110-WT and its K296R, K744R and enzymatically inactive mutants (H615Q/E617A, denoted as E617A) 24 and 48 h after cell transfection. The data are related to the results described in A. C Quantification of RNA editing of FLNB transcript described in A obtained from three independent experiments. Data are mean ± SEM. **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001. D Sanger sequencing chromatograms showing RNA editing of FLNB and AZIN1 in HeLa cells 48 h after cell transfection. E Western blot analysis showing expression of ADAR1-WT and its mutants in HeLa cells. F Quantification of the data on RNA editing of FLNB and AZIN1 transcripts in HeLa cells obtained from four independent experiments. Data are mean ± SEM. ***P ≤ 0.001, ****P ≤ 0.0001. G Sanger sequencing chromatograms showing the efficiency of FLNB editing 24 and 48 h after cell transfection with either equal amounts of ADAR1 (4 μg for both WT and K744R) or at the threefold increase of ADAR1-K744R mutant (4 μg for WT and 12 μg for K744R) to equalize expression of K744R to its WT counterpart. H Immunoblot analysis showing expression levels ADAR1-WT and ADAR1-K744R described in G. I Quantification of the data on RNA editing of FLNB transcript described in (G and H) obtained from three independent experiments. Data are Mean ± SEM. **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001

Article Snippet: SMURF2 CRISPR cells were generated by using the CRISPR/Cas9 genome editing tool (Cat# KN210866 , Origene), as described [ 41 ].

Techniques: Mutagenesis, Sequencing, Transfection, Construct, Western Blot, Expressing

SMURF2 regulates ADAR1 protein–protein interactions and functions. A Venn diagram showing the total number of ADAR1-associated proteins identified by LC–MS/MS in HEK-293T cells expressing either MYC-SMURF2 or Empty-MYC vector. B Protein classes of ADAR1-interacting partners, whose abundance was either increased or decreased by SMURF2 using the PANTHER classification system. C The cellular localization of ADAR1-associated proteins affected by SMURF2 (using the UniProtKB tool). ER, endoplasmic reticulum. D Protein–protein interaction network of the ADAR1 interactome obtained using STRING 11.0 platform. Only the interactors connected within the network are shown. Proteins are indicated by nodes labeled with the encoding gene symbol. Clusters identified by k-means clustering are shown in different colors. E–G GO enrichment analysis of biological processes, cellular components and molecular functions of ADAR1-interacting proteins enriched by SMURF2. Note that only the top 10 enriched functions and processes are shown (the detailed data are presented in Supplementary Table 4). GO terms were considered significant when they showed Benjamini and Hochberg adjusted FDR (q-value FDR B&H) < 0.05

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: The E3 ubiquitin ligase SMURF2 stabilizes RNA editase ADAR1p110 and promotes its adenosine-to-inosine (A-to-I) editing function

doi: 10.1007/s00018-022-04272-8

Figure Lengend Snippet: SMURF2 regulates ADAR1 protein–protein interactions and functions. A Venn diagram showing the total number of ADAR1-associated proteins identified by LC–MS/MS in HEK-293T cells expressing either MYC-SMURF2 or Empty-MYC vector. B Protein classes of ADAR1-interacting partners, whose abundance was either increased or decreased by SMURF2 using the PANTHER classification system. C The cellular localization of ADAR1-associated proteins affected by SMURF2 (using the UniProtKB tool). ER, endoplasmic reticulum. D Protein–protein interaction network of the ADAR1 interactome obtained using STRING 11.0 platform. Only the interactors connected within the network are shown. Proteins are indicated by nodes labeled with the encoding gene symbol. Clusters identified by k-means clustering are shown in different colors. E–G GO enrichment analysis of biological processes, cellular components and molecular functions of ADAR1-interacting proteins enriched by SMURF2. Note that only the top 10 enriched functions and processes are shown (the detailed data are presented in Supplementary Table 4). GO terms were considered significant when they showed Benjamini and Hochberg adjusted FDR (q-value FDR B&H) < 0.05

Article Snippet: SMURF2 CRISPR cells were generated by using the CRISPR/Cas9 genome editing tool (Cat# KN210866 , Origene), as described [ 41 ].

Techniques: Liquid Chromatography with Mass Spectroscopy, Expressing, Plasmid Preparation, Labeling

(A–D) Microsomal membranes from control or Hhat −/− T47D cells (A and B) or Hhat −/− MEFs (C and D) were pretreated for 15 min with 10 μM TDI-3410, 10 μM Etomoxir, or both drugs, and the uptake of NBD-palmitoyl-CoA (A and C) or [ 125 I] IodoPalmitoyl-CoA (B and D) was determined as described in . (A) n = 4; (B) n = 2; (C) n = 3; and (D) n = 2. (E) Microsomal membranes from (C) were pretreated for 15 min with 10 μM TDI-3410, 10 μM Etomoxir, or both drugs, and the NBD-palmitoyl-CoA uptake assay was performed at room temperature or at 0°; n = 3.

Journal: Cell reports

Article Title: Hedgehog Acyltransferase Promotes Uptake of Palmitoyl-CoA across the Endoplasmic Reticulum Membrane

doi: 10.1016/j.celrep.2019.11.110

Figure Lengend Snippet: (A–D) Microsomal membranes from control or Hhat −/− T47D cells (A and B) or Hhat −/− MEFs (C and D) were pretreated for 15 min with 10 μM TDI-3410, 10 μM Etomoxir, or both drugs, and the uptake of NBD-palmitoyl-CoA (A and C) or [ 125 I] IodoPalmitoyl-CoA (B and D) was determined as described in . (A) n = 4; (B) n = 2; (C) n = 3; and (D) n = 2. (E) Microsomal membranes from (C) were pretreated for 15 min with 10 μM TDI-3410, 10 μM Etomoxir, or both drugs, and the NBD-palmitoyl-CoA uptake assay was performed at room temperature or at 0°; n = 3.

Article Snippet: HHAT −/− T47D , OriGene , CRISPR Kit# KN208447.

Techniques:

KEY RESOURCES TABLE

Journal: Cell reports

Article Title: Hedgehog Acyltransferase Promotes Uptake of Palmitoyl-CoA across the Endoplasmic Reticulum Membrane

doi: 10.1016/j.celrep.2019.11.110

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: HHAT −/− T47D , OriGene , CRISPR Kit# KN208447.

Techniques: Recombinant, Mutagenesis, CRISPR, Software

A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. CRISPR/Cas9 knockout of PPIA /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .

Journal: bioRxiv

Article Title: A novel role for the peptidyl-prolyl cis-trans isomerase Cyclophilin A in DNA-repair following replication fork stalling via the MRE11-RAD50-NBS1 complex

doi: 10.1101/2023.06.27.546694

Figure Lengend Snippet: A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. CRISPR/Cas9 knockout of PPIA /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .

Article Snippet: The PPIA /CyPhA CRISPR system from Origene (Cat# KN203307) was used according to the manufacturer’s instructions and is composed of KN203307G1; PPIA gRNA vector 1 in pCas-Guide vector (Target Sequence: GGCAATGTCGAAGAACACGG).

Techniques: Quantitation Assay, CRISPR, Knock-Out, Stable Transfection, Variant Assay, Activity Assay, Expressing, Western Blot, Control

Human Dbr1 has a disordered C-terminal domain. A , summary of primary sequence alignment of Dbr1 homologs from human, mice, yeast, and amoeba. The catalytic metallophosphoesterase (MPE) domain is conserved across phyla. The lariat-recognition loop (LRL) is unique to Dbr1 enzymes. Metazoan Dbr1 enzymes have a long, conserved C-terminal domain that is absent in lower eukaryotes. B , the C-terminal domain is predicted to be disordered based on the primary sequence (PONDR analysis). C , predicted 3 dimensional structure of human Dbr1 colored by pLDDT score, with blue = high confidence and red = low confidence. The active site metals are shown as spheres . The C terminus is red and lacks secondary structure. D , 1D proton NMR confirms that human Dbr1 contains random-coil polypeptide when expressed in either E. coli ( black spectra ) or Sf9 insect cells ( red spectra ). The methyl region is shown ( middle ) with the regions corresponding to random coil and structured polypeptide labeled. The amide region is identical for both preparations ( bottom ).

Journal: The Journal of Biological Chemistry

Article Title: Activation of human RNA lariat debranching enzyme Dbr1 by binding protein TTDN1 occurs though an intrinsically disordered C-terminal domain

doi: 10.1016/j.jbc.2023.105100

Figure Lengend Snippet: Human Dbr1 has a disordered C-terminal domain. A , summary of primary sequence alignment of Dbr1 homologs from human, mice, yeast, and amoeba. The catalytic metallophosphoesterase (MPE) domain is conserved across phyla. The lariat-recognition loop (LRL) is unique to Dbr1 enzymes. Metazoan Dbr1 enzymes have a long, conserved C-terminal domain that is absent in lower eukaryotes. B , the C-terminal domain is predicted to be disordered based on the primary sequence (PONDR analysis). C , predicted 3 dimensional structure of human Dbr1 colored by pLDDT score, with blue = high confidence and red = low confidence. The active site metals are shown as spheres . The C terminus is red and lacks secondary structure. D , 1D proton NMR confirms that human Dbr1 contains random-coil polypeptide when expressed in either E. coli ( black spectra ) or Sf9 insect cells ( red spectra ). The methyl region is shown ( middle ) with the regions corresponding to random coil and structured polypeptide labeled. The amide region is identical for both preparations ( bottom ).

Article Snippet: The Dbr1 KO cells were generated using an Origene kit (KN200024) following the manufactures instructions.

Techniques: Sequencing, Proton NMR, Labeling

Role of the Dbr1 C-terminal domain. A , analytical ultracentrifugation shows that Dbr1 proteins with C-terminal truncations aggregate. Full-length Dbr1 (aa. 1–544) is monodisperse, while Dbr1-502 and DBr1-399 self-associate to produce species with very large S-values. B , Western blot of soluble and insoluble E. coli lysates shows soluble expression residues 1 to 399 and longer ( top blot , soluble lysate), and insoluble expression for residues 1 to 332 and shorter ( bottom blot , insoluble lysate). C , debranching activity is measured for residues 1 to 399 and longer variants only. D , purified Dbr1 proteins contain ∼1 Fe and ∼0.7 Zn ions per monomer following expression in E. coli or Sf9-insect cells. Metal-free Apo-Dbr1 has 0.06 Zn ions per monomer and <0.00 equivalents of Fe, Ni, Cu, Mn, or Co. E , anaerobic metal reconstitution assays with apo hDbr1. Maximal rates were 3.2 ± 0.1 s −1 with Fe 2+ , 0.8 ± 0.02 s −1 with Mn 2+ , and 0.5 ± 0.03 s −1 with Zn 2+ .

Journal: The Journal of Biological Chemistry

Article Title: Activation of human RNA lariat debranching enzyme Dbr1 by binding protein TTDN1 occurs though an intrinsically disordered C-terminal domain

doi: 10.1016/j.jbc.2023.105100

Figure Lengend Snippet: Role of the Dbr1 C-terminal domain. A , analytical ultracentrifugation shows that Dbr1 proteins with C-terminal truncations aggregate. Full-length Dbr1 (aa. 1–544) is monodisperse, while Dbr1-502 and DBr1-399 self-associate to produce species with very large S-values. B , Western blot of soluble and insoluble E. coli lysates shows soluble expression residues 1 to 399 and longer ( top blot , soluble lysate), and insoluble expression for residues 1 to 332 and shorter ( bottom blot , insoluble lysate). C , debranching activity is measured for residues 1 to 399 and longer variants only. D , purified Dbr1 proteins contain ∼1 Fe and ∼0.7 Zn ions per monomer following expression in E. coli or Sf9-insect cells. Metal-free Apo-Dbr1 has 0.06 Zn ions per monomer and <0.00 equivalents of Fe, Ni, Cu, Mn, or Co. E , anaerobic metal reconstitution assays with apo hDbr1. Maximal rates were 3.2 ± 0.1 s −1 with Fe 2+ , 0.8 ± 0.02 s −1 with Mn 2+ , and 0.5 ± 0.03 s −1 with Zn 2+ .

Article Snippet: The Dbr1 KO cells were generated using an Origene kit (KN200024) following the manufactures instructions.

Techniques: Analytical Ultracentrifugation, Western Blot, Expressing, Activity Assay, Purification

Dbr1 interacts with TTDN1 and Drn1. A , whole-cell proteomics HEK293 cells with Dbr1 KO or Dbr1 overexpression reveal that TTDN1 protein levels are determined Dbr1 protein levels. The transfection conditions are indicated below the columns. B , Western blot validation of the proteomic results. The blotting antibodies are indicated on the right. ΔNLS refers to Dbr1 with the nuclear localization sequence deleted. The parent 293 cell line is in the rightmost lane. C , size-exclusion chromatography demonstrates that Dbr1 and Drn1 form robust complex. The elution volume of an IgG standard is indicated above the x-axis (∼150 kDa). A Coomassie-stained gel of the peak fraction is presented. D , the polarization of fluorescently labeled TTDN1 increases with increasing Dbr1 concentration, suggesting a direct interaction and a K d of approximately 3 nM. No increase in polarization was observed when Drn1 was added to TTDN1. TTDN1, trichothiodystrophy nonphotosensitive 1.

Journal: The Journal of Biological Chemistry

Article Title: Activation of human RNA lariat debranching enzyme Dbr1 by binding protein TTDN1 occurs though an intrinsically disordered C-terminal domain

doi: 10.1016/j.jbc.2023.105100

Figure Lengend Snippet: Dbr1 interacts with TTDN1 and Drn1. A , whole-cell proteomics HEK293 cells with Dbr1 KO or Dbr1 overexpression reveal that TTDN1 protein levels are determined Dbr1 protein levels. The transfection conditions are indicated below the columns. B , Western blot validation of the proteomic results. The blotting antibodies are indicated on the right. ΔNLS refers to Dbr1 with the nuclear localization sequence deleted. The parent 293 cell line is in the rightmost lane. C , size-exclusion chromatography demonstrates that Dbr1 and Drn1 form robust complex. The elution volume of an IgG standard is indicated above the x-axis (∼150 kDa). A Coomassie-stained gel of the peak fraction is presented. D , the polarization of fluorescently labeled TTDN1 increases with increasing Dbr1 concentration, suggesting a direct interaction and a K d of approximately 3 nM. No increase in polarization was observed when Drn1 was added to TTDN1. TTDN1, trichothiodystrophy nonphotosensitive 1.

Article Snippet: The Dbr1 KO cells were generated using an Origene kit (KN200024) following the manufactures instructions.

Techniques: Over Expression, Transfection, Western Blot, Sequencing, Size-exclusion Chromatography, Staining, Labeling, Concentration Assay

Kinetic analysis of m ixtures of Dbr1, Dbr1+Drn1, and Dbr1+TTDN1 assayed with a fluorescent branched RNA substrate. A , TTDN1 increases the affinity of Dbr1 for bRNA substrate. B , at higher substrate concentrations, the presence of Drn1 or TTDN1 cause substrate inhibition. C , Coomassie stained gel of the enzyme mixtures used in A and B . D , TTDN1 does not stimulate EhDbr1, which lacks a disordered C-terminal domain. IgG served as a control. Drn1 and TTDN1 have no debranching activity in the absence of Dbr1. E , results of curve fitting. The data in A were fit with a version of the Michaelis–Menten equation which includes a Hill-coefficient (n H ), and in B , the equation was modified to include a substrate-inhibition term (K i ). TTDN1, trichothiodystrophy nonphotosensitive 1.

Journal: The Journal of Biological Chemistry

Article Title: Activation of human RNA lariat debranching enzyme Dbr1 by binding protein TTDN1 occurs though an intrinsically disordered C-terminal domain

doi: 10.1016/j.jbc.2023.105100

Figure Lengend Snippet: Kinetic analysis of m ixtures of Dbr1, Dbr1+Drn1, and Dbr1+TTDN1 assayed with a fluorescent branched RNA substrate. A , TTDN1 increases the affinity of Dbr1 for bRNA substrate. B , at higher substrate concentrations, the presence of Drn1 or TTDN1 cause substrate inhibition. C , Coomassie stained gel of the enzyme mixtures used in A and B . D , TTDN1 does not stimulate EhDbr1, which lacks a disordered C-terminal domain. IgG served as a control. Drn1 and TTDN1 have no debranching activity in the absence of Dbr1. E , results of curve fitting. The data in A were fit with a version of the Michaelis–Menten equation which includes a Hill-coefficient (n H ), and in B , the equation was modified to include a substrate-inhibition term (K i ). TTDN1, trichothiodystrophy nonphotosensitive 1.

Article Snippet: The Dbr1 KO cells were generated using an Origene kit (KN200024) following the manufactures instructions.

Techniques: Inhibition, Staining, Control, Activity Assay, Modification

Branchpoint specificity assay . A , branched RNAs with A-, C-, G-, and U-branchpoint nucleotides were synthesized using solid-phase synthesis. B , cleavage of branched RNAs was measured with microcapillary electrophoresis. A pseudo-gel image is displayed for the Dbr1 cleavage reactions. C , quantification of Dbr1 cleavage data. D , quantification of Dbr1+TTDN1 cleavage data. E , the rates of bRNA cleavage were estimated from the slopes in C and D and normalized to the rates for A -branchpoint RNA. TTDN1, trichothiodystrophy nonphotosensitive 1.

Journal: The Journal of Biological Chemistry

Article Title: Activation of human RNA lariat debranching enzyme Dbr1 by binding protein TTDN1 occurs though an intrinsically disordered C-terminal domain

doi: 10.1016/j.jbc.2023.105100

Figure Lengend Snippet: Branchpoint specificity assay . A , branched RNAs with A-, C-, G-, and U-branchpoint nucleotides were synthesized using solid-phase synthesis. B , cleavage of branched RNAs was measured with microcapillary electrophoresis. A pseudo-gel image is displayed for the Dbr1 cleavage reactions. C , quantification of Dbr1 cleavage data. D , quantification of Dbr1+TTDN1 cleavage data. E , the rates of bRNA cleavage were estimated from the slopes in C and D and normalized to the rates for A -branchpoint RNA. TTDN1, trichothiodystrophy nonphotosensitive 1.

Article Snippet: The Dbr1 KO cells were generated using an Origene kit (KN200024) following the manufactures instructions.

Techniques: Synthesized, Electrophoresis

TTDN1 increases the affinity of Dbr1 for bRNA when compared to Dbr1 only . TTDN1 could bind to the Dbr1 C-terminal tail and help recruit RNA to the active site, which could also help remove product and therefore reduce product inhibition. Although Drn1 and Dbr1 form a robust complex, we did not observe an enhancement of debranching kinetics. TTDN1, trichothiodystrophy nonphotosensitive 1.

Journal: The Journal of Biological Chemistry

Article Title: Activation of human RNA lariat debranching enzyme Dbr1 by binding protein TTDN1 occurs though an intrinsically disordered C-terminal domain

doi: 10.1016/j.jbc.2023.105100

Figure Lengend Snippet: TTDN1 increases the affinity of Dbr1 for bRNA when compared to Dbr1 only . TTDN1 could bind to the Dbr1 C-terminal tail and help recruit RNA to the active site, which could also help remove product and therefore reduce product inhibition. Although Drn1 and Dbr1 form a robust complex, we did not observe an enhancement of debranching kinetics. TTDN1, trichothiodystrophy nonphotosensitive 1.

Article Snippet: The Dbr1 KO cells were generated using an Origene kit (KN200024) following the manufactures instructions.

Techniques: Inhibition